Journal: bioRxiv

Article Title: Acid-Sensing Ion Channels Mediate Type III Adenylyl Cyclase-Independent Acid-Sensing of Mouse Olfactory Sensory Neurons

doi: 10.1101/765420

Figure Lengend Snippet: Top, a schematic of acidic volatiles in the air inhaled into the mouse nasal cavity. Bottom, the MOE on the top enlarged to the bottom with single OSN shown to the right. Acidic volatiles (e.g., acetic acid) are dissolved in mucosa and dissociated into protons (H+) and base (acetate). Based on our data, we propose that OSNs in the MOE can be stimulated by protons and base separately. While the base moiety initiates the conventional AC3-medaited cAMP pathway in olfactory cilia, protons directly activate ASICs expressed in the knob, dendrite, and soma, promoting the depolarization of OSNs. As ASICs are more widely expressed than individual subclass of receptor-specific OSNs, ASIC activation may unselectively depolarize different subclasses of OSNs, interfering with the anatomical logic of neural information transmission for specific odorants.

Article Snippet: To examine whether other ASIC subtypes are expressed in the mouse MOE, we tested an anti-ASIC2 antibody (Catalog# ASC-012, Alomone Labs).

Techniques: Activation Assay, Transmission Assay

Journal:

Article Title: Characterization of Acid-Sensing Ion Channel Expression in Oligodendrocyte-Lineage Cells

doi: 10.1002/glia.20693

Figure Lengend Snippet: Primers and Taqman Gene Assay Kits Used in This Study

Article Snippet: Agarose (2%) minigels were loaded with 10 μL PCR product, and stained with SYBR Gold (Invitrogen) and imaged with a CCD camera-based gel documentation system (Kodak, Rochester, NY). table ft1 table-wrap mode="anchored" t5 TABLE 1 caption a7 Gene name ASIC subtype Forward primer Reverse primer ABI Taqman assay number ACCN1 ASIC2 (nonselective) GGCAACGGGCTGGAGATCAT GCAGCAACTTCATACGCCTTCTTC Rn00563654_m1 ASIC2a GCCAATACCTCCACTCTCCATGG GGCAGGTACTCATCTTGCTGAATGTC ASIC2b TCCAAGGGGGACCTCTACTA CCATCCTCGCCTGAGTTAAA ACCN2 ASIC1 (nonselective) GACCATGAAAGGTGGGACTGGC CTGCTCGATGGTCTCATAGTTGAGG ASIC1a CTTGCCCACATCTTCTCCTATGAGC CATGTTGAAGGGCTTGGGCTTG Rn00577292_m1 ASIC1b Rn01532749_m1 ACCN3 ASIC3 GCTCACGCCTCACACCCAATGA GTGTAGCATTGCCCCATTCGAGT Rn00597579_m1 ACCN4 ASIC4 GCACTCAGCGATGCTGATATCTTCC GGTAGGTATTCCTCCTGCTGGATGTC Rn00573723_m1 GAPDH (NA) Rn99999916_s1 Open in a separate window Primers and Taqman Gene Assay Kits Used in This Study Quantitative RT-PCR was performed using Taqman hydrolysis probes (ABI, Foster City, CA), as specified in .

Techniques: Gene Assay, TaqMan Assay

Journal:

Article Title: Characterization of Acid-Sensing Ion Channel Expression in Oligodendrocyte-Lineage Cells

doi: 10.1002/glia.20693

Figure Lengend Snippet: Expression of ASIC transcripts in cultured OLC detected by RT-PCR. (A) Conventional RT-PCR products visualized after 35 cycles of PCR; total RNA templates from OP, IO, or MO cultures. The primer combinations used were as given in Table 1. The DNA size markers are at 100 base pair intervals. For each gel photograph the expected product size in base pairs, followed (in italics) by the size of the DNA marker indicated by the white arrowheads are: ASIC1a, 375 (300); ASIC2, 641 (600); ASIC3, 267 (200); ASIC4, 332 (300). (B) Summary of quantitative PCR results to compare relative expression of ASIC genes in OLC developmental stages and whole brain. Bars for each gene assay, for each tissue source, represent the mean relative value normalized to GAPDH level from the same tissue, as described in Methods. The error bars are standard errors, derived from three to six separate determinations for each gene/tissue combination. Whole brain (WB) RNA was used for comparison to RNA templates for each OLC developmental stage.

Article Snippet: Agarose (2%) minigels were loaded with 10 μL PCR product, and stained with SYBR Gold (Invitrogen) and imaged with a CCD camera-based gel documentation system (Kodak, Rochester, NY). table ft1 table-wrap mode="anchored" t5 TABLE 1 caption a7 Gene name ASIC subtype Forward primer Reverse primer ABI Taqman assay number ACCN1 ASIC2 (nonselective) GGCAACGGGCTGGAGATCAT GCAGCAACTTCATACGCCTTCTTC Rn00563654_m1 ASIC2a GCCAATACCTCCACTCTCCATGG GGCAGGTACTCATCTTGCTGAATGTC ASIC2b TCCAAGGGGGACCTCTACTA CCATCCTCGCCTGAGTTAAA ACCN2 ASIC1 (nonselective) GACCATGAAAGGTGGGACTGGC CTGCTCGATGGTCTCATAGTTGAGG ASIC1a CTTGCCCACATCTTCTCCTATGAGC CATGTTGAAGGGCTTGGGCTTG Rn00577292_m1 ASIC1b Rn01532749_m1 ACCN3 ASIC3 GCTCACGCCTCACACCCAATGA GTGTAGCATTGCCCCATTCGAGT Rn00597579_m1 ACCN4 ASIC4 GCACTCAGCGATGCTGATATCTTCC GGTAGGTATTCCTCCTGCTGGATGTC Rn00573723_m1 GAPDH (NA) Rn99999916_s1 Open in a separate window Primers and Taqman Gene Assay Kits Used in This Study Quantitative RT-PCR was performed using Taqman hydrolysis probes (ABI, Foster City, CA), as specified in .

Techniques: Expressing, Cell Culture, Reverse Transcription Polymerase Chain Reaction, Marker, Real-time Polymerase Chain Reaction, Gene Assay, Derivative Assay, Comparison